View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_high_56 (Length: 247)
Name: NF1894_high_56
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_high_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 28 - 228
Target Start/End: Original strand, 6458118 - 6458317
Alignment:
| Q |
28 |
ctcttctgatcgatccttttagnnnnnnntaggtttcacatggaggcaatcctattaaaccattaaaccacggtctcattttttagtattcaatcaaatt |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6458118 |
ctcttctgatcgatccttttagaaaaaaataggtttcacatggaggcaatcctattaaaccattaaaccacggtctcattttttagtattcaatcaaatt |
6458217 |
T |
|
| Q |
128 |
aaggtttcggtggtggatatgtgcgatttggggtgggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggaggagctgttag |
227 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6458218 |
aaggttt-ggtggtggatatgtgtgatttggggtgggagaaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggagaaggagctgttag |
6458316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 146 - 228
Target Start/End: Complemental strand, 4331561 - 4331479
Alignment:
| Q |
146 |
atgtgcgatttggggtgggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggaggagctgttagg |
228 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||| ||| | | ||||||||| | || ||||||||| ||||||| |
|
|
| T |
4331561 |
atgtgcgatttgggatgggaggaaggaggggtggcttggcagtggtggtggcggttgtgggcgtgagaggaggagatgttagg |
4331479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 182 - 228
Target Start/End: Original strand, 28993070 - 28993116
Alignment:
| Q |
182 |
tggcaatggcgtcgtcggttgtggacttgggaggaggagctgttagg |
228 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
28993070 |
tggcagtggcgtcggcggttgtggacttgggaggaggagttgttagg |
28993116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 219
Target Start/End: Original strand, 33276166 - 33276241
Alignment:
| Q |
144 |
atatgtgcgatttggggtgggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggagga |
219 |
Q |
| |
|
||||||| | ||| ||||||||||||||||| ||| ||||| |||||||||||||||| | | ||||||||||| |
|
|
| T |
33276166 |
atatgtgtggtttagggtgggaggaaggaggtgcggcttggcagtggcgtcgtcggttgtaggcatgggaggagga |
33276241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 228
Target Start/End: Original strand, 14852330 - 14852416
Alignment:
| Q |
142 |
ggatatgtgcgatttggggtgggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggaggagctgttagg |
228 |
Q |
| |
|
||||||||||| ||| ||||||||||| || ||| ||| ||||| ||||| || ||||||||| | |||||||||| |||||||| |
|
|
| T |
14852330 |
ggatatgtgcggtttagggtgggaggatggtggggcggcttggcagtggcgccgccggttgtgggttggggaggaggaactgttagg |
14852416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University