View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_high_70 (Length: 217)
Name: NF1894_high_70
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_high_70 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 33722928 - 33722744
Alignment:
| Q |
15 |
caaaggtgctaaagttcacagtgcatggtttaaatggccaactctcaaactctgctcaactgatttgagaaaacagatttcaaataagaagaagaggaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33722928 |
caaaggtgctaaagttcacagtgcatggtttaaatggccaactctcaaactctgctcaactgatttgagaaaacagatttcaaataagaagaagaggaag |
33722829 |
T |
 |
| Q |
115 |
aaagattcagctactggtctttttgtgttcccggttcagtctagagtaactggggctaagtattcgtaccagtggatggccttgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33722828 |
aaagattcagctactggtctttttgtgttcccggttcagtctagagtaactggggctaagtattcgtaccagtggatggccttgg |
33722744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 33705343 - 33705160
Alignment:
| Q |
16 |
aaaggtgctaaagttcacagtgcatggtttaaatggccaactctcaaactctgctcaactgatttgagaaaacagatttcaaataagaagaagaggaaga |
115 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33705343 |
aaaggtgccaaagtgcacagtgcatggtttaaatggccaactctcaaactttgctcgactgatttgagaaaacaaatttcaaataagaagaagaggaaga |
33705244 |
T |
 |
| Q |
116 |
aagattcagctactggtctttttgtgttcccggttcagtctagagtaactggggctaagtattcgtaccagtggatggccttgg |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33705243 |
aggattcagctactggtctttttgtgttccctgttcagtctagagtaactggggctaagtattcgtaccagtggatggcgttgg |
33705160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University