View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_low_31 (Length: 322)
Name: NF1894_low_31
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 41282550 - 41282372
Alignment:
| Q |
18 |
atatctcctactagcaaatgacctcaacgatggagtcttacatttccatctttattcaacgttccaataatgcggcgagtctgggtttatttatgagata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41282550 |
atatctcctactagcaaatgacctcaacgatggagtcttacatttccatctttattcaacgttctaataatgcggcgagtctgggtttatttatgagata |
41282451 |
T |
 |
| Q |
118 |
gataaatacatagatatattcgagaaattcatattttaataagtggatttcacttataagtctcatcacttgtgtcaat |
196 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41282450 |
gataaatacatagatttattcgagaaattcatattttaataagtggatttcacttataagtctcatcacttgtgtcaat |
41282372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 208 - 310
Target Start/End: Complemental strand, 41282343 - 41282241
Alignment:
| Q |
208 |
agtaaataatagaacaaatctagttagttatctagatnnnnnnnnnngaccatctctctagtgacatcttgtgacggggatgtacatcttcttttgtttt |
307 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41282343 |
agtaaataatagagcaaatctagttagttatctagataaaaaaaaaagaccatctctctagtgacatcttgtgacggggatgtacatcttcttttgtttt |
41282244 |
T |
 |
| Q |
308 |
tca |
310 |
Q |
| |
|
||| |
|
|
| T |
41282243 |
tca |
41282241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University