View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_low_41 (Length: 292)
Name: NF1894_low_41
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 39783510 - 39783238
Alignment:
| Q |
1 |
tctccgttactgatattgaagttgcatatgtctttgctataacttatactgaccaatgcagcttcaatcatagtcaaaaactcatagacatcnnnnnnnt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39783510 |
tctccattactgatattgaagttgcatatgtctttgctataacttatactgaccaatgcagcttcaatcatagtcaaaaactcatagacatcaaaaaaat |
39783411 |
T |
 |
| Q |
101 |
tgatgtcacgaccaatattgaagctgcatcggccatttgatgtctatgcgagtttgtgactatgattgaagttgcatcagtcgttcttgaatgcacactg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783410 |
tgatgtcacgaccaatattgaagctgcatcggccatttgatgtctatgcgagtctgtgactatgattgaagttgcatcagtcgttcttgaatgcacactg |
39783311 |
T |
 |
| Q |
201 |
gcaaacatagaacnnnnnnnaaaaccatacgtcaattgagtgttgcgagaattttctttcaggtatacgagct |
273 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783310 |
gcaaacatagaactttttttaaaaccatacgtcaattgagtgttgcgagaattttctttcaggtatacgagct |
39783238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University