View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_low_55 (Length: 250)
Name: NF1894_low_55
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 12164190 - 12164024
Alignment:
| Q |
1 |
cattcatgtatctatgttaataacatcaattcccacgttagctcatccttgattaaattgtaatttagttaaattggatcaaa-ccaac-ttaatttaac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||| ||||| || ||||||| |
|
|
| T |
12164190 |
cattcatgtatctatgttaataacatcaattcccacgttagttcatccttgattaaattgtaatttagttgaattagatcaactccaacgttgatttaac |
12164091 |
T |
 |
| Q |
99 |
catgatccaaaagtctcacttttcaatctccggttcaaattttaaagcactgcttctcataaactac |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12164090 |
catgatccaaaagtctcacttttcaatctccggttcaaattttaaagcactgcttctcataaactac |
12164024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University