View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_low_68 (Length: 235)
Name: NF1894_low_68
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 36464867 - 36464645
Alignment:
| Q |
1 |
tccacctagtaccaaaaacattcttatg--attctgttaggttcctactaccaccaaaatgacaaaaaa-caactaactaaaccaatgaatgattgtaag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36464867 |
tccacctagtaccaaaaacattcttatgtgattctgttaggttcctactaccaccaaaatgacaaaaaaacaactaactaaaccaatgaatgattgtaag |
36464768 |
T |
 |
| Q |
98 |
aacaaatattaaataaatattcttacggatgatttgtatatctgtatatctttagattagatatcccaattttatgtaaggatttcataagttgtctcag |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464767 |
aacaaatattaaataaatattcttatggatgatttgtatatctgtatatctttagattagatatcccaattttatgtaaggatttcataagttgtctcag |
36464668 |
T |
 |
| Q |
198 |
acagaaatctaatatcaagtatt |
220 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
36464667 |
acacaaatctaatatcaagtatt |
36464645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University