View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_low_73 (Length: 220)
Name: NF1894_low_73
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 4395250 - 4395063
Alignment:
| Q |
15 |
cagagaacaacaagttaggaccaatagtatttcgtttttcatgtcctaccccaagtttattcaaggtatacttgacataaggccaaatgtgtttttatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395250 |
cagagaacaacaagttaggaccaatagtatttcgtttttcatgtcctaccccaagtttattcaaggtatacttgacataaggccaaatgtgtttttatgt |
4395151 |
T |
|
| Q |
115 |
gttggtcacattcaatttgttataaaattcgttcaccgatggatgtggacaaaaattgagcaacttaatagttttcaatggtttttta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395150 |
gttggtcacattcaatttgttataaaattcgttcaccgatggatgaggacaaaaattgagcaacttaatagttttcaatggtttttta |
4395063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University