View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_high_34 (Length: 240)
Name: NF18950_high_34
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 4604012 - 4603817
Alignment:
| Q |
20 |
acaatacctatatgtggagctagttcttaaatcaatttggcnnnnnnnnnnnnngattggtcaaatccatttctttagcaatgaactcgaccaatttttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4604012 |
acaatacctatatgtggagctagttcttaaatcaatttggtgaaaaagaaaaaagattggtcaaatccatttctttagcaatgaactcgaccaatttttc |
4603913 |
T |
 |
| Q |
120 |
aggatttccaatcaattggaagccatggaaaaggatagtttattggaatgtttaagggaggcattagtatttccatgttcctgcttcctccctcat |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4603912 |
aggatttccaatcaattggaagccatgtaaaaggatagtttcttggaatgtttaagggaggcattagtatttccgtgttcctgcttcctccctcat |
4603817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University