View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18950_high_40 (Length: 211)

Name: NF18950_high_40
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18950_high_40
NF18950_high_40
[»] chr1 (1 HSPs)
chr1 (67-197)||(50761728-50761858)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 67 - 197
Target Start/End: Complemental strand, 50761858 - 50761728
Alignment:
67 ttgattattattgattgaaaatggcgggtgatagttgggtactgatggttactgctcagacaccaaccaacattgctgtgataaagtattggggtaaaag 166  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
50761858 ttgattattattgattggaaatggcgggtgatagttgggtactgatggttacagctcagacaccaaccaacattgctgtgataaagtattggggtaaaag 50761759  T
167 agatgaaaccctaatcttacctgttaatgat 197  Q
    |||||||||||||||||||||||||||||||    
50761758 agatgaaaccctaatcttacctgttaatgat 50761728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University