View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_19 (Length: 351)
Name: NF18950_low_19
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 9 - 335
Target Start/End: Complemental strand, 37135620 - 37135294
Alignment:
| Q |
9 |
agcagagataccggagacagcatacgacaaaacaacggcaggaccagcctcctcacgagcttcaagaccggtgagaacaaaaatgccggaaccgacgact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37135620 |
agcagagataccggagacagcatacgacaaaacaacggcaggaccagcctcctcacgagcttcaagaccggtgagaacaaaaatgccggaaccgacaact |
37135521 |
T |
|
| Q |
109 |
gcaccgattccgaaccaaataagatcccaaccattcagagttttcttcatttggtggctgcttctagctttcatctccacaatttccatgtaatcttttg |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135520 |
gcgccgattccgaaccaaataagatcccaaccattcagagttttcttcatttggtggctgcttctagctttcatctccacaatttccatgtaatcttttg |
37135421 |
T |
|
| Q |
209 |
atcgtgtaaacattctatctttcaacctgtatggtgttttcatgaatgcttttccataatcacctaaacttttgaatgaatcttctgggaaaaactcatt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135420 |
atcgtgtaaacattctatctttcaacctgtatggtgttttcatgaatgcttttccataatcacctaaacttttgaatgaatcttctgggaaaaactcatt |
37135321 |
T |
|
| Q |
309 |
tcttgctccactgttttctgttcccat |
335 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37135320 |
tcttgctccactgttttctgttcccat |
37135294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University