View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_20 (Length: 344)
Name: NF18950_low_20
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 137 - 331
Target Start/End: Complemental strand, 8015739 - 8015544
Alignment:
| Q |
137 |
caaagtatagagaaatatccaaaataattatgaggataaccaagaattttcctaaaa-gttatccacaaaaaagtcaagcattggaaatacagtatacag |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8015739 |
caaagtatagagaaatatccaaaataattatgaggataaccaagaattttcctaaaaagttatccacagaaaagtcaagctttggaaatacagtatacac |
8015640 |
T |
 |
| Q |
236 |
tgaaaaattgactaattctaatcgtgcatgtatagaagtagaatagaatcaaaactgctctaacaactggcgtactgaaattgtattattggacct |
331 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8015639 |
tgaaaaattgactaattccaatcgtgcatgtattgaagtagaacagaatcaaaactgctctaacaactggcgtactgaaattgtattattggacct |
8015544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 8015844 - 8015793
Alignment:
| Q |
16 |
atatgctcacggaaccctgttctaaaatttaattgaatagaatactcaacat |
67 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8015844 |
atatgctcacgggaccctgttctaaaatttaattgaatagaatactcaacat |
8015793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University