View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_22 (Length: 336)
Name: NF18950_low_22
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 167 - 321
Target Start/End: Complemental strand, 9617523 - 9617370
Alignment:
| Q |
167 |
gtttaaaaatatattgagccgacatgcattcaaattcaattgaagtcaaaatnnnnnnngtgatgcatgttgcaagcaaaagtgcaaatgcaaaacaaac |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9617523 |
gtttaaaaatatattgagccgacatgcattcaaattcaattgaagtcaaaataaaaaa-gtgatgcttgttgcaagcaaaagtgcaaatgcaaaacaaac |
9617425 |
T |
|
| Q |
267 |
cattggaggtgatagttgtatgaacagcaatgctagctatagcctatgataatct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9617424 |
cattggaggtgatagttgtatgaacagcaatgctagctatagcctatgataatct |
9617370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 12 - 77
Target Start/End: Complemental strand, 9617678 - 9617613
Alignment:
| Q |
12 |
agagagcactaagagcagacaggttaatgatccatggcgatcaagagattgaattctacgtcttca |
77 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
9617678 |
agagagcactaagagcagacagattaattatccatggcaatcaagagattgaattctacgttttca |
9617613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University