View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_25 (Length: 294)
Name: NF18950_low_25
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 43259238 - 43259022
Alignment:
| Q |
17 |
aaagaagaaatataccaagctggtggttatttt--gctagcagttnnnnnnntatgattactatcttattacatgaataaattattgttaactatctttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43259238 |
aaagaagaaatataccaagctggtggttattttttgctagcagttaaaaaaatatgattactatcttattacatgaataaattattgttaactatctttt |
43259139 |
T |
 |
| Q |
115 |
ttaatatgactgaagttagatatgcttttaacaatccacatctacttctaaatgagtcgagtcatnnnnnnncaacgttgctatatgctgtgtatgttgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43259138 |
ttaatatgactgaagttagatatgcttttaacaatccacatctacttctaaatgagtcgagtcataaaaaaacaacgttgctatatgctgtgtatgttgt |
43259039 |
T |
 |
| Q |
215 |
gttcaaatattaactag |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43259038 |
gttcaaatattaactag |
43259022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 278
Target Start/End: Complemental strand, 43259037 - 43259008
Alignment:
| Q |
249 |
ttcaaatattaactagttattagtcccatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43259037 |
ttcaaatattaactagttattagtcccatt |
43259008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University