View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_31 (Length: 252)
Name: NF18950_low_31
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 2 - 144
Target Start/End: Original strand, 4570948 - 4571090
Alignment:
| Q |
2 |
caacaaacggtagctaattattgttgagataaatcgtcatttcgggtgccttaaagcaaactattacgctatagttgatcgtaggtaattgatgggtaaa |
101 |
Q |
| |
|
|||| |||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
4570948 |
caacgaacggtagctaactattgttgaggtaaagcgtcatttcgggtgccttaaagcaaactattatgctatagttcatcataggtaattgatgggtaaa |
4571047 |
T |
|
| Q |
102 |
ttcgacttagtagctttggttagagttagttactccaactaat |
144 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
4571048 |
ctcgacttagtagctttggttagagttaattacttcaactaat |
4571090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 216 - 245
Target Start/End: Original strand, 4571162 - 4571191
Alignment:
| Q |
216 |
ttgtatctccctcatgatcggtcctatgct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4571162 |
ttgtatctccctcatgatcggtcctatgct |
4571191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University