View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_33 (Length: 250)
Name: NF18950_low_33
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 8015556 - 8015317
Alignment:
| Q |
1 |
tattattggacctgctgctatctactctcctccagtatctctttgcagtatttgcttcttttcaattcaaaaagtggttttattcg---acacatcatat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8015556 |
tattattggacctgctgctatctactctcctccagtatctctttgcagtatttgcttcttttcaattcaaaaagtggttttattcgtatacacatcatat |
8015457 |
T |
|
| Q |
98 |
atacgtacttttatttatttgtggtatttataatatgcattggttatttatcagttcattttaattagtcaagaaataagttatgagaatatgcgtgaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8015456 |
atacgtacttttatttatttgtggtatttataatatgcattggttatttatcagttcattttaattagtcaagaaataagttatgagaatatgcgtgaaa |
8015357 |
T |
|
| Q |
198 |
gagtagttgttagataagatgtggcatttcacgtgagcct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8015356 |
gagtagttgttagataagatgtggcatttcacgtgagcct |
8015317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University