View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_37 (Length: 248)
Name: NF18950_low_37
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 39 - 248
Target Start/End: Original strand, 3300309 - 3300510
Alignment:
| Q |
39 |
attagttagatgagatttgagcgtgaggggtaataaaaggtgagtggttttgatttgatgaatgagcaacattgtaagcaatgagttggaaatgagtagt |
138 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
3300309 |
attagttaaatgagatttgagtgtgaggagtaataaaaggtgagtggttttgatttgatga----gcaacattgtaagtattgagttggaaatgagtagt |
3300404 |
T |
 |
| Q |
139 |
gaataaaattacgtggatgaagggttctgcatggtttggcttttgcgtgggaaattttgggggtggtttcctattttgtacatacttgtgtatgtgtgtg |
238 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
3300405 |
gaataacattacgtagatgaagggttttgcatggtttggcttttgcgtgggaaattttggaggtggtttcctattttgtac----ttgtgtatgtgtcct |
3300500 |
T |
 |
| Q |
239 |
gtgtcttttt |
248 |
Q |
| |
|
|||||||||| |
|
|
| T |
3300501 |
gtgtcttttt |
3300510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University