View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_42 (Length: 221)
Name: NF18950_low_42
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 10471215 - 10471028
Alignment:
| Q |
15 |
cataggagaaagaaccactcttgtttaacataatgaaaaaaggcttcatatttcactctctttattttttgtcaagtcatatttcactctctatttagat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10471215 |
cataggagaaagaaccactcttgtttaacataatgaaaaa-ggcttcatatttcactctctttattttttgtcaagtcatatttcactctctatttagat |
10471117 |
T |
|
| Q |
115 |
atatatctattccaaaataatagatattttcatttgacaaattgaatttttacagcatttaacaattacgagaaaataaagttaacata |
203 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
10471116 |
atatatctattgcaaaataatagatattttcatttgacaagttgaatttttacagtatttaacaattacgagaaaataaagttagcata |
10471028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University