View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_44 (Length: 211)
Name: NF18950_low_44
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 67 - 197
Target Start/End: Complemental strand, 50761858 - 50761728
Alignment:
| Q |
67 |
ttgattattattgattgaaaatggcgggtgatagttgggtactgatggttactgctcagacaccaaccaacattgctgtgataaagtattggggtaaaag |
166 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50761858 |
ttgattattattgattggaaatggcgggtgatagttgggtactgatggttacagctcagacaccaaccaacattgctgtgataaagtattggggtaaaag |
50761759 |
T |
|
| Q |
167 |
agatgaaaccctaatcttacctgttaatgat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50761758 |
agatgaaaccctaatcttacctgttaatgat |
50761728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University