View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_46 (Length: 208)
Name: NF18950_low_46
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 48411617 - 48411794
Alignment:
| Q |
14 |
agatgaatgagttggtgatttagggatgaaaggtagttgttgagttgtgaacggagagtgtggaagggaacgaaggttggaagttgagagatgtgtgatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48411617 |
agatgaatgagttggtgatttagggatgaaaggtagttgttgagttgtgaacggagagtgtggaagggaacgaaggttggaagttgagagatgtatgatt |
48411716 |
T |
 |
| Q |
114 |
cggaatcgaagttaggggagaggaacggttcgggtttgaaccagagagggtcggagaagaggttcgtgacggttctgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48411717 |
cggaatcgaagttaggggagaggaacggttcgggtttgaaccagagagggtcggagaagaggttcgtgacggttctgt |
48411794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 14 - 138
Target Start/End: Complemental strand, 42824808 - 42824684
Alignment:
| Q |
14 |
agatgaatgagttggtgatttagggatgaaaggtagttgttgagttgtgaacggagagtgtggaagggaacgaaggttggaagttgagagatgtgtgatt |
113 |
Q |
| |
|
|||| |||||| | ||||||||| || || || ||||||||||||| || |||||||||| ||| || ||||||||| | |||| || |||| |||| |
|
|
| T |
42824808 |
agatcaatgagctcgtgatttagcgacgagagatagttgttgagttccgatcggagagtgtcgaatgggacgaaggttcggagttcggaaatgtaggatt |
42824709 |
T |
 |
| Q |
114 |
cggaatcgaagttaggggagaggaa |
138 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
42824708 |
cggaatcgaagtcaggggagaggaa |
42824684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University