View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18950_low_47 (Length: 201)
Name: NF18950_low_47
Description: NF18950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18950_low_47 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 2 - 201
Target Start/End: Complemental strand, 38697891 - 38697692
Alignment:
| Q |
2 |
taatacttacgtttagaagttttttattttctaaatatttggactattaaaattagttgttatgttccatagtaaacgttttggtggcttggaaaataca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38697891 |
taatacttacgtttagaagttttttattttctaaatatttggactattaaaattagttgttatgttccatagtaaacgttttggtggcttggaaactaca |
38697792 |
T |
 |
| Q |
102 |
taccgattcgagggctttaattctgatagtaaattgtactgttttgtattcgtcattggacctgcagaccatgagaccaagaatatatatgtgctgaact |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38697791 |
taccgattcgagagctttaattctgatagtaaattgtactgttttgtattcgtcattggacctgcagaccatgagaccaagaatatatatgtgctgaact |
38697692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University