View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18951_high_16 (Length: 225)
Name: NF18951_high_16
Description: NF18951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18951_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 83 - 181
Target Start/End: Complemental strand, 7962694 - 7962596
Alignment:
| Q |
83 |
accgtctcaatctagaagatttaatacttggtacatatagatgggtaggaggtcaactaatcaaagatcatcgtgaggcgacatttgcattgaaggaca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||| |||| ||||||| |||||| |
|
|
| T |
7962694 |
accgtctcaatctagaagatttaatacttggtaaatatagatgggtaggaggtcaacaaatcaaagattatcgtgagacgacgactgcattgcaggaca |
7962596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 17 - 121
Target Start/End: Complemental strand, 7973552 - 7973449
Alignment:
| Q |
17 |
cataggctgtgcatgtgaagaagtttacacatgtgatattcttgttcatgtttccttgtttaaagaaccgtctcaatctagaagatttaatacttggtac |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||| | ||||| || ||||| ||||||||||||||||| |||||||||||| |||| | ||| |||||||| |
|
|
| T |
7973552 |
cataggttgtgcatgtgaagaagtttacacctctgatactcctgttcttgtttccttgtttaaag-accgtctcaatccagaatctgtaacacttggtaa |
7973454 |
T |
 |
| Q |
117 |
atata |
121 |
Q |
| |
|
||||| |
|
|
| T |
7973453 |
atata |
7973449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University