View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18951_low_10 (Length: 304)
Name: NF18951_low_10
Description: NF18951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18951_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 43 - 215
Target Start/End: Original strand, 16810294 - 16810466
Alignment:
| Q |
43 |
agagcatccggtgagacctcttatttattatgagaaatgaaaacaatcatttatgtaacataaatttatttaagaatgtgtttgtaaactaatttcatgt |
142 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16810294 |
agagcatctggtgagacctcttatttattttgagaaatgagaacaatcatttatgtaacataaatttatttaagaatgtgtttgtaaactaatttcatgt |
16810393 |
T |
 |
| Q |
143 |
aatattgaaaacatgtactttaattattaattttctatagatctatttcacgtaacaacacgagagtaatttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16810394 |
aatattgaaaacatgtactttaattattaattttctatagatctatttcacgtaacaacacgagagtaatttc |
16810466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 232 - 293
Target Start/End: Original strand, 16810452 - 16810513
Alignment:
| Q |
232 |
cacgagagtaatttcctttttctccaaataaacaaaatcacatgattaatcttttttccttt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16810452 |
cacgagagtaatttcctttttctccaaataaacaaaatcacatgattaatcttttttgcttt |
16810513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 48 - 95
Target Start/End: Original strand, 26821361 - 26821408
Alignment:
| Q |
48 |
atccggtgagacctcttatttattatgagaaatgaaaacaatcattta |
95 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
26821361 |
atccggtgagaactcttatttattgtgagaaatgagaacaattattta |
26821408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 5365194 - 5365144
Alignment:
| Q |
48 |
atccggtgagacctcttatttattatgagaaatgaaaacaatcatttatgt |
98 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||| | |||||||| |
|
|
| T |
5365194 |
atccggtgagaactcttatttattgtgagaaatgagaacatttatttatgt |
5365144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University