View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18951_low_18 (Length: 225)

Name: NF18951_low_18
Description: NF18951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18951_low_18
NF18951_low_18
[»] chr8 (2 HSPs)
chr8 (83-181)||(7962596-7962694)
chr8 (17-121)||(7973449-7973552)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 83 - 181
Target Start/End: Complemental strand, 7962694 - 7962596
Alignment:
83 accgtctcaatctagaagatttaatacttggtacatatagatgggtaggaggtcaactaatcaaagatcatcgtgaggcgacatttgcattgaaggaca 181  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||| ||||   ||||||| ||||||    
7962694 accgtctcaatctagaagatttaatacttggtaaatatagatgggtaggaggtcaacaaatcaaagattatcgtgagacgacgactgcattgcaggaca 7962596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 17 - 121
Target Start/End: Complemental strand, 7973552 - 7973449
Alignment:
17 cataggctgtgcatgtgaagaagtttacacatgtgatattcttgttcatgtttccttgtttaaagaaccgtctcaatctagaagatttaatacttggtac 116  Q
    |||||| ||||||||||||||||||||||| | ||||| || ||||| ||||||||||||||||| |||||||||||| ||||  | ||| ||||||||     
7973552 cataggttgtgcatgtgaagaagtttacacctctgatactcctgttcttgtttccttgtttaaag-accgtctcaatccagaatctgtaacacttggtaa 7973454  T
117 atata 121  Q
    |||||    
7973453 atata 7973449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University