View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18951_low_21 (Length: 216)
Name: NF18951_low_21
Description: NF18951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18951_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 12612971 - 12612800
Alignment:
| Q |
15 |
atgaaattgagcagagtgtggcagcgaagagtctggtcaagcagagtgagattgattggaggcagtgccattggttcagtg---tgcagtgcattgctgg |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
12612971 |
atgaaattgagcagagtgtggcagtgaagtgtctggtcaagcagagtgagattgattggaggcagtgccattggctcagtgcagtgcagtgcattgctgg |
12612872 |
T |
 |
| Q |
112 |
gttaaaacccatcctgctagactatctctgtcaccttactttcactcaatgttaggtagttgtgagttgtga |
183 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12612871 |
gttaaaacccatcctgctatactatctctgccaccttactttcactcaatgttaggtagttgtgacttgtga |
12612800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University