View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18951_low_8 (Length: 318)
Name: NF18951_low_8
Description: NF18951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18951_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 16 - 299
Target Start/End: Complemental strand, 43879777 - 43879494
Alignment:
| Q |
16 |
ctgagatgcatgtatgagtggtttgagatttacacctgaacaaattacattcaaatgattaaaggttaaatcccggtagaagaatatgaaagggaacact |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43879777 |
ctgagatgcatgtatgagtggtttgagatttacacctgaacaaattacattcaaatgattaaaggttaaatcccggtagaagaatatgaaagggagcact |
43879678 |
T |
 |
| Q |
116 |
aaaatgacattctaacgacaaaggcttacgtaatcgattacactcctctacataaacggttttccctttcatagcatcttgcttaatggactcccacgat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43879677 |
aaaatgacattctaacgacaaaggcttacgtaatcgattacactcctctacataaacggttttccctttcatagcatcttgcttaatggactcccacgat |
43879578 |
T |
 |
| Q |
216 |
gatttcagtttctggatgtttgcaaatcaagcacaaaattgtaatgtttggcaccacaattataacattgacattgacacattt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43879577 |
gatttcagtttctggatgtttgcaaatcaagcacaaaattgtaatgtttggcaccacaattataacattgacattgacacattt |
43879494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University