View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18952_high_6 (Length: 257)
Name: NF18952_high_6
Description: NF18952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18952_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 257
Target Start/End: Original strand, 3572959 - 3573203
Alignment:
| Q |
13 |
aatatctaatctaatatccgctcaacgcaaccagacaaatggactcatatttgtaacaaaatgttgaggtaaatgaaatcaatgtatgttaacctctcag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3572959 |
aatatctaatctaatatccgctcaacgcaaccagacaaatggactcatatttgtaacaaaatgttgaggtaaatgaaatcaatgtatgttaacctctcag |
3573058 |
T |
 |
| Q |
113 |
gctctcagctgagaataacaacacaagcttctttgtctgacaatttatctaggatgcataagtgaaggtactaggcagaatcatgaaaataccccatttt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3573059 |
gctctcagctgagaataacatcacaagcttctttgtctgacaatttatctaggatgcataagtaaaggtactaggcagaatcacgaaaataccccatttt |
3573158 |
T |
 |
| Q |
213 |
ttgagatattttccgggtggcagggttccagaatcggagccagta |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573159 |
ttgagatattttccgggtggcagggttccagaatcggagccagta |
3573203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University