View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18952_low_12 (Length: 237)
Name: NF18952_low_12
Description: NF18952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18952_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 121 - 220
Target Start/End: Original strand, 32224659 - 32224758
Alignment:
| Q |
121 |
cctagttggatttgcaaaaacttgtgtttctttgtctcgtgattctcacaattattttaatatatgtattttcacaacaatcttttcccatgttaaatgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
32224659 |
cctagttggatttgcaaaaacttgtgtttctttgtctcgtgattctcacaattattttaatatatgttttttcacaacaagcttttcctatgttaaatgt |
32224758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 32224542 - 32224587
Alignment:
| Q |
1 |
ctccaattccacctctttttcattctctccctcccgcacgtgtgag |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224542 |
ctccaattccacctctttttcattctctccctcccgcacgtgtgag |
32224587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University