View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18953_low_8 (Length: 263)
Name: NF18953_low_8
Description: NF18953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18953_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 110 - 226
Target Start/End: Complemental strand, 49462059 - 49461934
Alignment:
| Q |
110 |
cactaagccaaaaattgattacaatactatatcattttatactacccaaaaattaaaggaacctca---------tatgacatggtcaaaatgaacatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49462059 |
cactaagccaaaaattgattacaatactatatcattttatactacccaaaaattaaaggaacctcaaaccattgttatgacatggtcaaaatgaacatgt |
49461960 |
T |
|
| Q |
201 |
tgatagcagtgtctcattaagttttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49461959 |
tgatagcagtgtctcattaagttttt |
49461934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 49462180 - 49462152
Alignment:
| Q |
1 |
cacgatgctttgatctccacccaagactc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49462180 |
cacgatgctttgatctccacccaagactc |
49462152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University