View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18953_low_9 (Length: 251)
Name: NF18953_low_9
Description: NF18953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18953_low_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 36317379 - 36317136
Alignment:
| Q |
8 |
tcgaagaatatggatccatcttcccatgtggacaatcagaaggtacttccttgcttttgtatccacatttactaaacatatatgtctacaactttaaggc |
107 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36317379 |
tcgaaaaatatggattcatcttcccatgtggacaatcagaaggtacttccttgcttttgtatccacatttactaaacatatatgtctacaactttaaggc |
36317280 |
T |
 |
| Q |
108 |
taatgcctttattatggccaacaactttattacattagtatttacatataaattttttaaatggaatatctaattaagtttatatatacatgcaggtgga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36317279 |
taatgcctttattatggccaacaactttattacattagtatttacatataaattttttaaatggaatatctaattaagtttatatatacatgcaggtgga |
36317180 |
T |
 |
| Q |
208 |
aactcctctctttgatgataattttgtggaattgtaccaaccaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36317179 |
aactcctctctttgatgataattttgtggaattgtaccaaccaa |
36317136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University