View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18955_high_18 (Length: 225)
Name: NF18955_high_18
Description: NF18955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18955_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 25 - 155
Target Start/End: Complemental strand, 288219 - 288089
Alignment:
| Q |
25 |
cctttttactgttgctaatattctgaatcttcattatatgttccttttcttctgaatatcattcgtgtgatatttaatttttatatgaacacaaccattt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
288219 |
cctttttactgttgctaatattctgaatcttcattatatgttccttttcttctgaatatcatgcgtgtgatattttatttttatatgaacacaaccattt |
288120 |
T |
|
| Q |
125 |
agaaaaaagatattcgatgatttaatttttc |
155 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||| |
|
|
| T |
288119 |
agaaaaaagctattcaatgatctaatttttc |
288089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University