View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18955_high_5 (Length: 419)
Name: NF18955_high_5
Description: NF18955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18955_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 1 - 407
Target Start/End: Complemental strand, 6388206 - 6387800
Alignment:
| Q |
1 |
ataccacgatagtcattcttctcttctcattgatgatccaaagaaaattgcaaccaggtgatatatatagatataaacttttcttccttagaaactaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6388206 |
ataccacgatagtcattcttctcttctcattgatgatccaaagaaaattgcaaccaggtgatatatatagatataaacttttcttccttagaaactaaat |
6388107 |
T |
|
| Q |
101 |
tgaatgtcgaaaatccctacttacttttcaaatttctacacaacatgtagttacatgtccacctggtttgttttggatatctgctcaacagcaccacttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6388106 |
tgaatgtcgaaaatccctacttacttttcaaatttctacacaacatgtagttacatgtccacctggtttgttttggatatctgctcaacagcaccacttg |
6388007 |
T |
|
| Q |
201 |
agcctattagtctcctcttcactacttatgacagtgagcttggtttcaaacttcttaacatgttgcgattatggcgcctgagacgagtcagttctctgtt |
300 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6388006 |
agcccattagtctcctcttcactacttatgacagtgagcttggtttcaaacttcttaacatgttgcgattatggcgcctgagacgagtcagttctctgtt |
6387907 |
T |
|
| Q |
301 |
tgcaaggtttgccagcatgttatatttaatttcatggttctgttttcatcaagtcttctatttactagaatatttcagtgctttcttccttacttgcacc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6387906 |
tgcaaggtttgccagcatgttatatttaatttcatggttctgttttcatcaattcttctatttactagaatatttcagtgctttcttccttacttgcacc |
6387807 |
T |
|
| Q |
401 |
tttgctt |
407 |
Q |
| |
|
||||||| |
|
|
| T |
6387806 |
tttgctt |
6387800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University