View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18955_high_6 (Length: 403)
Name: NF18955_high_6
Description: NF18955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18955_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 46863350 - 46863137
Alignment:
| Q |
18 |
aagatgagaatattggtagaaaaacatcatgggatgatcaaagtttaaggtttgaggtannnnnnnncatgggttcacgttcaccgccggtgtttataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46863350 |
aagatgagaatattggtagaaaaaattcatgggatgatcaaagtttaaggtttgaggtattttttttcatgggttcacgttcaccgccggtgtttataaa |
46863251 |
T |
|
| Q |
118 |
gaaagagacaaaattggaatatgtagtgactagtgaggcagtgacgaggtttaaggttttatagttgggaccaccaagtcaaaaccctagccacaactat |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46863250 |
gaaagagacaaaattggagtatgtagtgactagtgaggcagtgacgaggtttaaggttttttagttgggaccaccaagtcaaaaccctagccacaactat |
46863151 |
T |
|
| Q |
218 |
tacactatcctttc |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46863150 |
tacactatcctttc |
46863137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 299 - 389
Target Start/End: Complemental strand, 46863140 - 46863050
Alignment:
| Q |
299 |
tttcatgttgtctttgagtacgattaaggaagagtttttattttctatcatattttataaatgggttaattaagtttgtgtttggttgagt |
389 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46863140 |
tttcatgttgtctttgggtacgattaaggaagagtttttattttctatcatattttataaatgggttaattaagtttgtgtttggttgagt |
46863050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University