View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18955_low_13 (Length: 239)
Name: NF18955_low_13
Description: NF18955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18955_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 147 - 224
Target Start/End: Original strand, 28470666 - 28470743
Alignment:
| Q |
147 |
catataactattcatggtttctttaaatctgacactttcatatttctctcatacttgctcctttatctgtatatttgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28470666 |
catataactattcatggtttctttaaatctgacactttcatatttctctcatacttgctcctttatctgtatatttgt |
28470743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 89
Target Start/End: Original strand, 28470576 - 28470608
Alignment:
| Q |
57 |
ccaaaatggtcactggtttctgcatttgaacta |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28470576 |
ccaaaatggtcactggtttctgcatttgaacta |
28470608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University