View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18955_low_15 (Length: 237)
Name: NF18955_low_15
Description: NF18955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18955_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 118 - 220
Target Start/End: Original strand, 12338950 - 12339052
Alignment:
| Q |
118 |
ctcccttcatctcttatttatatgactctccaacaaagttgagtgactaaaaatatatttgtaagagcaaatatgtcaaaaatatgttatttttatgagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12338950 |
ctcccttcatctcttatttatatgactctccaacaaagttgagtgactaaaaatatatttgtaagagtaaatatgtcaaaaatatgttatttttatgagt |
12339049 |
T |
 |
| Q |
218 |
agt |
220 |
Q |
| |
|
||| |
|
|
| T |
12339050 |
agt |
12339052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 12338833 - 12338890
Alignment:
| Q |
1 |
tactcgccaatagtagccatcaactgcatcatcatgtttttcaccttcagctagagag |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12338833 |
tactcgccaatagtagccatcaactgcatcatcatgtttttcaccttgagctagagag |
12338890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University