View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18956_high_1 (Length: 418)
Name: NF18956_high_1
Description: NF18956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18956_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 141 - 336
Target Start/End: Original strand, 36237602 - 36237797
Alignment:
| Q |
141 |
atttttgtatcagaactaacttccagacaaattatgttgtctaggtgatacatgatgctaatatttaaatagtgagtggggattcttatgaatattgaaa |
240 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36237602 |
atttttgtatcagaactaacttcaagacaaattatgttgtctaggtgctacatgatgctaatatttaaatagtgagtagggattcttatgaatattgaaa |
36237701 |
T |
|
| Q |
241 |
gtaaaatttggatgcaaggtaataaactgtatgttttggacttcctggatggggctatgaggcatttataaacaactataatccagattttgttta |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36237702 |
gtaaaatttggatgcaaggtaataaactgtatgttttggacttcctggatggggctatgaggcatttataaacaactataatccagattttgttta |
36237797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 27 - 113
Target Start/End: Original strand, 36237499 - 36237580
Alignment:
| Q |
27 |
gtcttctaaaataaagcccataatataacatgactttatcttattttannnnnnnaaaacttatcaatcctaacatgagttcaaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
36237499 |
gtcttctaaaataaagcccataatattgcatgactttattttatttt-----tttaaaacttttcaatcctaacatgagttcaaatt |
36237580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University