View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18957_high_10 (Length: 391)
Name: NF18957_high_10
Description: NF18957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18957_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 3246197 - 3245948
Alignment:
| Q |
17 |
attagttgcaaaagcagtggaagcaagggaatgcggtcgtgtatggcgaggaagattatcattttctttgtcataatgggaatcaaatgcagaaacagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3246197 |
attagttgcaaaagcagtggaagcaagggaatgcggtcgtgtatggcgaggaagattatcattttctttgtcataatgggaatcaaatgcagaaacagac |
3246098 |
T |
 |
| Q |
117 |
atagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcgatctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3246097 |
atagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcgatctg |
3245998 |
T |
 |
| Q |
217 |
aacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245997 |
aacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg |
3245948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University