View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18957_high_33 (Length: 204)
Name: NF18957_high_33
Description: NF18957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18957_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 13 - 118
Target Start/End: Original strand, 44414108 - 44414214
Alignment:
| Q |
13 |
gagatgaatcaacaattataattttaattccatttt-tctttgttnnnnnnntttaatattttcatatgattagtgtaatattacgtgactcgtgtgaat |
111 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44414108 |
gagatgaattaacaatgataattttaattccattttgtctttgttaaaaaaaattaatattttcatatgattagtgtaatattacgtgcctcgtgtgaat |
44414207 |
T |
 |
| Q |
112 |
taacatg |
118 |
Q |
| |
|
||||||| |
|
|
| T |
44414208 |
taacatg |
44414214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 186
Target Start/End: Original strand, 44414222 - 44414256
Alignment:
| Q |
152 |
actacttgcatttatgacattaaatagggtgaaga |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44414222 |
actagttgcatttatgacattaaatagggtgaaga |
44414256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University