View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18957_low_16 (Length: 322)
Name: NF18957_low_16
Description: NF18957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18957_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 87 - 306
Target Start/End: Complemental strand, 50763631 - 50763412
Alignment:
| Q |
87 |
gatgcaaaagcgactttgatggaaggagaatactacacattggttgtgtacagaataaatatatgttgggttcaattagtgtaataaatggcatatttcc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50763631 |
gatgcaaaagcgactttgatggaaggagaatattacacattggttgtgtacagaataaatatatgttgagttcaattagtgtaataaatggcatatttcc |
50763532 |
T |
|
| Q |
187 |
caaaagaaattgaagttggatcagttacttgaatttagattagttttatttttcttcttttgataagcataatttagacaatttaatctagaatttgtgg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50763531 |
caaaagaaattgaagttggatcagttacttgaatttagataagttttatttttcttcttttgataagcataatttagacaatttaatctagaatttgtgg |
50763432 |
T |
|
| Q |
287 |
ggtttcaaagtaatgaaatg |
306 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
50763431 |
ggtttcaaagtaatgaaatg |
50763412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University