View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18957_low_34 (Length: 209)
Name: NF18957_low_34
Description: NF18957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18957_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 26 - 193
Target Start/End: Complemental strand, 38262038 - 38261871
Alignment:
| Q |
26 |
ttttatacttcaattcaaatgttcatgtcattttctagtaatgtgtttactacacatatatattatgtcaaattattacatgaggataatcaagtaccat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38262038 |
ttttatacttcaattcaaatgttcatgtcattttctagtaatgtgtttactacacatatatattatgtcaaattattacatgaggataatcaagtaccat |
38261939 |
T |
 |
| Q |
126 |
aaatttagggtatatatatgaagcaacatagaagtatagtttattccacatggtttggtcttacttac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38261938 |
aaatttagggtatatatatgaagcaacatagaagtatagtttattccatatggtttggtcttacttac |
38261871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University