View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18958_high_15 (Length: 428)
Name: NF18958_high_15
Description: NF18958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18958_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 261
Target Start/End: Original strand, 44375183 - 44375435
Alignment:
| Q |
9 |
agcataggcatagatggtagtgaccttaatgtgaatgactgaatgcacaatatctctctcacttagtacattgtacatgtacataaatggttgagctttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44375183 |
agcataggcatagatggtagtgaccttaatgtgaatgactgaatgcacaatatctctctcacttagtacattgtacatgtacataaatggttgagctttt |
44375282 |
T |
 |
| Q |
109 |
gtgatttcttccactttaatgtgttcatctatgttctttgtttattaagcgtcgctacgtgttcatgtgtgttcatgattagtttctgcgagtgtagtgt |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44375283 |
gtgatttctaccactttaatgtgttcatctatgttctttgtttattaagcgtcgctacgtgttcatgtgtgttcatgattagtttctgcgagtgtagtgc |
44375382 |
T |
 |
| Q |
209 |
atcaaaatatgtatagtaggaagtctttttttgacgcaatgtagtaggaagag |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44375383 |
atcaaaatatgtatagtaggaagtctttttttgacgcaatgtagtaggaagag |
44375435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 306
Target Start/End: Original strand, 41736175 - 41736204
Alignment:
| Q |
277 |
gaagagagagagtgaccatttatagactgg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41736175 |
gaagagagagagtgaccatttatagactgg |
41736204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University