View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18958_high_29 (Length: 275)
Name: NF18958_high_29
Description: NF18958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18958_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 24 - 252
Target Start/End: Complemental strand, 39027722 - 39027483
Alignment:
| Q |
24 |
tcaaccccttccgactggccaatgtagaaaa------atcacattcattccatcatttatgttgcaatgtacagttttaaccagatagacttcaaattgc |
117 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||||| | |||||||||| |||||||||||| | |||||| || |
|
|
| T |
39027722 |
tcaacccctgccgaccggccaatgtagaaaacctcgaatctcattcattccatcatttatgtgggaatgtacagtgttaaccagataggcctcaaatcgc |
39027623 |
T |
|
| Q |
118 |
atgggacgacgcatttctatat------ctagaacataacctactagatgacagttggacaagtcagtcattcagcagcttaatttttaattcttctaat |
211 |
Q |
| |
|
|||||||| ||||||||||| | ||| ||||| || | |||||||||| | ||| || || |||| |||||||| ||||| ||| | |||||| |
|
|
| T |
39027622 |
atgggacgtcgcatttctatttttattgctaaaacatggcc-aatagatgacagcttgaccagccaatcatacagcagctgaatttctaagttctctaat |
39027524 |
T |
|
| Q |
212 |
tgatcaatcctttgacaggcgatctgagtcttctccatgag |
252 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39027523 |
tgatcaatcctttgacacgcgatctgagtcttctccatgag |
39027483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 26 - 104
Target Start/End: Complemental strand, 39040668 - 39040590
Alignment:
| Q |
26 |
aaccccttccgactggccaatgtagaaaaatcacattcattccatcatttatgttgcaatgtacagttttaaccagata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
39040668 |
aaccccttccgactggccaatgtagaaaaatcacattcattccatcatttctgtggcaatgtacagttttaaccagata |
39040590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 130 - 187
Target Start/End: Complemental strand, 39040590 - 39040533
Alignment:
| Q |
130 |
atttctatatctagaacataacctactagatgacagttggacaagtcagtcattcagc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39040590 |
atttctatatctagaacataacctactagatgacagttggaccagtcagtcattcagc |
39040533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University