View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18958_high_45 (Length: 218)
Name: NF18958_high_45
Description: NF18958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18958_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 26901706 - 26901513
Alignment:
| Q |
8 |
tcgaagaatatgggagaaggtacgttgatgcgtttggagggattgctacggtgtgttgcgggcactgtcaccctgatgtggttgcagcgatcattgatca |
107 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
26901706 |
tcgatgaaaatgggagaaggtacgttgatgcgttcggagggattgctacggtgtgttgcgggcactgtcaccctgatgtggtttcagcgatcgttgatca |
26901607 |
T |
 |
| Q |
108 |
aacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagctttggctggtaaactccccggtgatctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901606 |
aacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagctttggctggtaaactccccggtgatctt |
26901513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University