View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18958_low_13 (Length: 455)
Name: NF18958_low_13
Description: NF18958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18958_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 264 - 439
Target Start/End: Complemental strand, 32372162 - 32371987
Alignment:
| Q |
264 |
tagaacaaagcagaacatgaatttgattctgggattcatgatgttttgttcaattaaccatgctgtttttattcccacaaaaagaacaaactttttctta |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32372162 |
tagaacaaagcagaacatgaatttgattctgggattcatgatgttttgttcaattaaccatgctgtttttattcccacaaaaagaacaaactttttctta |
32372063 |
T |
 |
| Q |
364 |
ccaattacacaatttcatggtgcaattcagttcgtttctgtttttcctgattatgggttctaaagatgattgaatt |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32372062 |
ccaattacacaatttcatggtgcaattcagttcgtttctgtttttcctgattatgggttctaaagatgattgaatt |
32371987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University