View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18958_low_37 (Length: 243)
Name: NF18958_low_37
Description: NF18958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18958_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 47653388 - 47653599
Alignment:
| Q |
19 |
gtagtgttagatctcttgatggttctagataattggcgtattattgctctcgatgtactctccagattctccaacaagtgatattatagctctagtttga |
118 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47653388 |
gtagtgttagatctcttggtggtcctagataattggcatactattgctctcgatgtactctccagattctccaacaaatgatattatagctctagtttga |
47653487 |
T |
 |
| Q |
119 |
cttgacggaggagcaatagtaaccacgatgtttgattgttgtataagaagtatttttaacgatgtagtcacgaggcatgttttgttggttgtaacgacag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47653488 |
cttgacggaggagcaatagtaaccacgatgtttgattgttgtataagaagtatttttaacgatgtagtcacgaggcatgttttgttggttgtaacgacag |
47653587 |
T |
 |
| Q |
219 |
tgcaagtataat |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47653588 |
tgcaagtataat |
47653599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University