View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1895_low_13 (Length: 237)
Name: NF1895_low_13
Description: NF1895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1895_low_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 2722138 - 2722359
Alignment:
| Q |
16 |
cagaaacagataatgccacattagctcaacatggttggagccctagagtaaccgccggtgacggctgcatgcgttctgaggccatgggcaattatgaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2722138 |
cagaaacagataatgccacattagctcaacatggttggagccctagagtaaccgccggtgacggctgcatgcgttctgaggccatgggcaattatgaaag |
2722237 |
T |
|
| Q |
116 |
cacagaacaggttgaaatgaaaccgtgccttccgttttcaaccacttcttagagaactttcagactaccaaacttgcccctagactcccaagtttgagtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2722238 |
cacagaacaggttgaaatgaaaccgtgccttccgttttcaaccacttcttagagaactttcagactaccaaacttgcccctagactcccaagtttgagcg |
2722337 |
T |
|
| Q |
216 |
agtgtatccgagtcggatggac |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2722338 |
agtgtatccgagtcggatggac |
2722359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University