View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1895_low_16 (Length: 210)

Name: NF1895_low_16
Description: NF1895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1895_low_16
NF1895_low_16
[»] chr4 (1 HSPs)
chr4 (1-200)||(54504977-54505173)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 54504977 - 54505173
Alignment:
1 atcactgtcaaagtcgccttcagtaccctcagagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggccccgtcatcttcaccttca 100  Q
    ||||||||||||||||||||||   ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
54504977 atcactgtcaaagtcgccttca---ccctccgagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggcaccgtcatcttcaccttca 54505073  T
101 gacgagtcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54505074 gacgagtcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt 54505173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University