View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18960_high_23 (Length: 249)

Name: NF18960_high_23
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18960_high_23
NF18960_high_23
[»] chr6 (1 HSPs)
chr6 (2-242)||(7678855-7679085)


Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 2 - 242
Target Start/End: Complemental strand, 7679085 - 7678855
Alignment:
2 tctagattactaaattaatgcatgcgctgattgcttgttagacaagttttttactctttagacatgattttgtacgatttgaatacaaactaattattat 101  Q
    ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
7679085 tctagatcactaaattaatgcatgcgctgattgcttgttagacaaattttttactctttagacatggttttgtacgatttaaatacaaactaattattat 7678986  T
102 tattattagatgaaaaaattagcccacatcatcagctatgtgtgagacagacaatacaagaagggagattattattactgtaacaatgacaaacaatgct 201  Q
    ||      ||||||||||||||||| |||||||||||||||||||||||    |||||||||||||||||| |||||||||||||||||| |||||||||    
7678985 ta------gatgaaaaaattagcccgcatcatcagctatgtgtgagaca----atacaagaagggagattaatattactgtaacaatgaccaacaatgct 7678896  T
202 tccccagtatgagggaaaatgttcttgactagtttcatttc 242  Q
    |||||||||||||||| ||||||||||||||||||| ||||    
7678895 tccccagtatgagggacaatgttcttgactagtttcgtttc 7678855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University