View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18960_low_10 (Length: 401)
Name: NF18960_low_10
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18960_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 392
Target Start/End: Original strand, 33825734 - 33826112
Alignment:
| Q |
18 |
acctaatgcaaaaccagtcttttgaaagagtttcctcaaacggcattacagaatattcttgctgttttcaattcctagtgaagagaaagaatccactttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825734 |
acctaatgcaaaaccagtcttttgaaagagtttcctcaaacggcattacagaatattcttgctgttttcaattcctagtgaagagaaagaatccactttc |
33825833 |
T |
 |
| Q |
118 |
actgaacttccgctctgcagctacttctgtttctcagctatgttgtcccactaaattgaattaagagaaatgatatttgtgtgacaaattttgaaacatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33825834 |
actgaacttccgctctgcagctacttgtgtttctcagctatgttgtcccgctaaattgaatt-agagaaatgatatttgtgggacaaattttgaaacatt |
33825932 |
T |
 |
| Q |
218 |
tctctt-gtaatttcattgtgttcttactctggttatctctcttttgtttttgtctc----nnnnnnnnnnnnnnnggagaaagaaggttatcctcaaat |
312 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||||||||||||||| |||| ||| ||||||||||||| ||||| |
|
|
| T |
33825933 |
tctcttagtaatttcattgcgttcttactctctttatctctcttttgtttttatctcaaaaaaaaaaaaaaaaaaaagaggaagaaggttatccccaaat |
33826032 |
T |
 |
| Q |
313 |
tattacaaaatgatttgacaaatatcattactctaaatttcattatcacacaccatctataaatagatgtcttggttgtc |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
33826033 |
tattacaaaatgatttgacaaatatcattactctaaatttcattatcacacaccatctataaatagatattttggttgtc |
33826112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University