View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18960_low_13 (Length: 346)
Name: NF18960_low_13
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18960_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 219
Target Start/End: Complemental strand, 48308864 - 48308654
Alignment:
| Q |
9 |
gattattctggtcattgcatgaaggaagcatatctggctatgacaatacctttgaaaagagaccttaccaccgtaaatgtggttgtgcacttcataataa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48308864 |
gattattctggtcattgcatgaaggaagcatatctggctatgacaatacctttgaaaagagaccttaccaccgtaaatgtggttgtgcacttcataataa |
48308765 |
T |
|
| Q |
109 |
aaagtcacgtatgaattacaagcacatgctaccaagttgttgtaacaagaccgtgtcttatcctatcaagaaagaacgtaggagtttggtcgtgaaaaca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48308764 |
aaagtcacgtatgaattacaagcacatgctaccaagttgttgtaacaggaccgtgtcttatcctatcaagaaagaacgtaggagtttggtcgtgaaaaca |
48308665 |
T |
|
| Q |
209 |
gcttcaactac |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
48308664 |
gcttcaactac |
48308654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 260 - 333
Target Start/End: Complemental strand, 48308613 - 48308540
Alignment:
| Q |
260 |
caagtaatgatgagtttggtaaaccttcaagagcaggaggaggagccaaatcacaagtatttttaaattattca |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48308613 |
caagtaatgatgagtttggtaaaccttcaagagcaggaggaggagccaaatcacaagtatttttaaattattca |
48308540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University