View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18960_low_24 (Length: 253)
Name: NF18960_low_24
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18960_low_24 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 24337156 - 24336922
Alignment:
| Q |
19 |
atgccaggccgccgcctcggtgtctccttagcaacctttggtttcaatggtgtccttattggactccttattgtaaactcagacatttgatcttcacaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24337156 |
atgccaggccgccgcctcggtgtctccttagcaacctttggtttcaatggtgtccttattggactccttattgtaaactcagacatttgatcttcacaat |
24337057 |
T |
|
| Q |
119 |
ctgacataactgcagcacttgcagttaccacactccattctatgcttgcctcactcggcgcataacaattcgggctaaggcaacttgaagcagcatctga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24337056 |
ctgacataactgcagcacttgcagttaccacactccattctatgcttgcctcactcggcgcgtaacaattcgggctaaggcaacttgaagcagcatctga |
24336957 |
T |
|
| Q |
219 |
tgtctgtctattaagaaaattgttcttggagggtt |
253 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||| |
|
|
| T |
24336956 |
tgtctgtctagtaagaaaattgttgttggagggtt |
24336922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 17744819 - 17744907
Alignment:
| Q |
133 |
gcacttgcagttaccacactccattctatgcttgcctcactcggcgcataacaattcgggctaaggcaacttgaagcagcatctgatgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||| || |||||| |||| || ||| ||||| |||||| ||| |||||| |
|
|
| T |
17744819 |
gcacttgcagttaccacactccattcaatgcttgcttcacttggtgcataaaaatttggactagtgcaaccagaagcaacatgtgatgt |
17744907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University